Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK682.2   

sjj_ZK682.2 RNAi (5)
PCR_productsjj_ZK682.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZK682.2 Source_evidenceePCR883WS150 Sequence/Annotation Release
Chunk_score Abs_score799
Max_abs_score799ZK682.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV92673549268524
Overlaps_transcript ZK682.2.2 Source_evidenceePCR883WS150 Sequence/Annotation Release
ZK682.2.1 Source_evidenceePCR883WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK682.21171tctgcgttgtggtttttgagtcatcaaaaattttagttcaatgttatgattacgtttaaaaaaattgtgattttgaatataaaaatgactcaccactcgaattacagaactttgtgatccgattgatatccgaccaatctcgttttcgggcggattcagccattcctgcgtagaacacttttgaaattaattgaagaacaaatggaagagcagaccaaagaccgttctaaaacattgaattcaacaaataaatggttttttttattggtcctaccgaagttaagctcatgttcaacacagttttatagtagagtggaagataggtgattgtaccgactgtcacgtagttatgtgcgaacgaagacgcagcgattgcccaaactacaggagatttcatcagagccatccagtttggatgttgtggacgtagtctgactctttctgttgtgatgtaatgaagttcatcccttgagagctttttatctgcatggcatggcgagtcatataccatcatgtaccaaatgatacacatcacgattccgcatactgcgtacacgtggaatgccataggccatccccatggcaattgacacaactcggcagttgcgaacatggcaatgactactgaaagttggttaccagtagttgcaattgctagggctgtcgatttttcattcacagggaaccattgggcgatgagaacaagcatacatggccataaaacaccctaaacatagaattaaaaataatactgccagatcatgttaatcacctgtccaaatcccattacaaatcgtaataggatgataggaaatgttccgaaattggtctgtgatgccacaaatggagtgagaaatgttccaacaacatttgcaattccaccgtacaaaacactccgtgttgctccaatatatcgatttagtacttcagatgccaatgttgcaacaagtcctccagcatagaaagcagcaaatataattgctctgtcttgtgatgtccaaaatattgttcctttctgtaacatttccaaatatttccttagattataaaagtaaacattaattatcttcctccttgtctactgctttttctaacccttcaaatttcaaagactcacgtgttcaactacttttgactctccgaactgtagtaatggacataaaggcgttgc