Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK682.5   

sjj_ZK682.5 RNAi JA:ZK682.5
Simmer:ZK682.5:Repeat_a
Simmer:ZK682.5:Screen
PCR_productsjj_ZK682.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK682.5 Source_evidenceePCR850WS150 Sequence/Annotation Release
Overlaps_Gene ZK682.5 Source_evidenceePCR850WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV92886819289845
Overlaps_transcriptZK682.5 Source_evidenceePCR850WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK682.51165ccttcgaaaaagtctgctcgaactcttaaaatatataaattaagatatgtcttcttaactaaacttactgggatagtctgttcttgttgagtacaatagcttgaatctgtggagttctttggaatgctcctctctcaattgtgtcaactgcagcttcagacatttcaagacgaatcaggtttggaatgtgctaaagtaaaaattgtctatggattcaataattaaaaatcagctaaccatgaatgcattgttaggaatgaccgagattggagtttctccgataccaagagtctttaactgagtgatgtatcggaacatttctggagcccaggatgggaatttgtttcctgtcatgtacaagaactgaagattcggaactccttggaaagcctgcggtggaatgacagtgattccattaaattctagtgaaagagacgagagaacagggaaatcaagagctccgactggaacctcattgattgagttgagtccgagattcaagttggtaagcgtgttgcgttggttgacaagagctgacgatggaatcgaggttaaggagttggtctcgagcgatagttcctaaaaattgcagatttagaaatgaacatttatacttttaaaaactgactattttcttaacatgtagattgcaatttatttttctgttaacctttcatttgaaaaattaatttcgtgagtatcataaacttaaccataagtacatattctaaaagtttttttggaaaaataaattcttacagaaaacatactaaaaatatatttagaacattaactattcatacctgaagaagagtcaaaggtctgaaaacagtggcatctccgagagtagcatctgtgagtctatttccagccaattccaatttcagtaacaaatctctcgactcaaatgcgttaaaagcggtagaagagagttgattgatacggttgcgattgaggtacaatttgcgaagatttcggagacgaggaatacctgtctgtggaatctgtccaagattgttgtcattcaggtcaagctcaatcaatgagtcaagaagtggaccattgaacgcctgatcgtcaatgttttgaagagtgtttctgttgagaacaagacgaaggattgtgaaactttggaaggcattcgcaggtattgtcgggattgcag