Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK686.3   

sjj_ZK686.3 RNAi (2)
PCR_productsjj_ZK686.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK686.3 Source_evidenceePCR837WS150 Sequence/Annotation Release
Overlaps_Gene ZK686.3 Source_evidenceePCR850WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII77677257768800
Overlaps_transcriptZK686.3 Source_evidenceePCR850WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK686.31076caggaagaaacgtttaggcgaagaggaatgagtatgggtatccacgatatttggagcggaagacagacagaaggaacgagaagaagacgcaaatgcacacaagtccagcgattgccaaagctgaaaatatgatattatgatagttctggaacttgcaataattattactgtttggaaaatacctatttattatcttcaaatttttttaaaaatttattcaaacttactgtttgtagggatattcaacaaggaaagtgggttcagcttctttccagcattctttctatctttgctgttcgactggtcggctgcttcattgacacaaatgaatccaatagcgatcaaagcatacaaaagtccgacgatgtaagtttcagcgatgagttggaattgagtggatccgtgaatgaatgatggttctttggtgttcgggttggtaatcatgaatggtggtccacgaatatgattccacatttgtccggacatgaagatgaaagtgatagcgaggcagacaaatccccacacagtcctattgaagaggaagtccaaactgtttctcttcatgtacaacattccaaggagcagtgcaacaaaaagagcaattacgactggagcagtatagtttggtgggcggataacacgaacatgaacttctgtctgatctgcaacaaatcgtccaatagcatcagcatcgaatccttgtctctggaagtccatttgctctggacgcttcttggcaccaagctttggtccgaaatggtagagaataggagctgtgttgaggttcatttgttggaagatttgtggagcatcttcatagtcaacaattccaaagaatactttacgacgatctccctcggagctggtgtagcggtgagagttggcgacaatcatgaattcatcgtaggccggtctagaaaaccaaataattaaaatttgtacgttgtattatgaacgttctaaatataatcattatttcggggagaaattttactttaattgtccgattgctccaattagaagttaacttacttgcaaattgggcattgaacacctggggaaagtgcagtgaacat