Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK792.3   

sjj_ZK792.3RNAiSimmer:ZK792.3
PCR_productsjj_ZK792.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK792.3 Source_evidenceePCR902WS150 Sequence/Annotation Release
Overlaps_Gene ZK792.3 Source_evidenceePCR902WS150 Sequence/Annotation Release
Chunk_score Abs_score839
Max_abs_score839ZK792.3
Specificity_index0.788
Rel_score1
Map_statusUnique_ePCRIV1167616411677820
ZK792.2 Chunk_score Abs_score226
Specificity_index0.212
Rel_score0.269
Overlaps_transcriptZK792.3 Source_evidenceePCR902WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK792.31657ataccacacagttgggaggccgacacatgttattgacaataatttttcgttctgtctgtccatgttttcaagcattttcaattttcaattcaatcattgattctcgaaagacaatatttcaatctcatttttaatttcgttcaatgaaaaattctttcagagcattgtcactttggttcaaagggacagaatgttttctgttccatttcttacctcattgacaagtcatcttgggatcacagcaattgatgatgcaagtgataccctttcatgtctcatcactgccttcctcttcatcatcgcagccattctcacttcagcccaaaggtaaattattttcagtcaacgtttttagtttcaccatgttgttttacgggccgtttctgggagtttaaaggattattttgtgagtatttcttcatagagaataaaatacaaatacgatatactgttgtagtactctgacttgaggtttcttcatttctctaattctttttcttaagtcatatctgtgaaacacaattcattattatgaaaacaaaaaacaataatttttgaaaccggaacccataggtttcgtttaaattttgtgataattgggattttgagatcccatactacttttttaaaaataactttagggcttaagggtttaatagcttccccagtctccaataattatttttgaatggaacaaaatcatttctagtaattgtattttaaaaattcaaaccttatagttaaacctattattttaaggagttgagttatctagaatccgagtttccaactgttcaaaacgttcaattaagtttaacttaaaaaaacgatcccactattttcagctatgttggctcagcgatggagtgctggcttcctcagacgtactcgggcgcttgggaagaatttgctgagaactactgcttcttgaaggacacctacttctatccaagacaacaatccatgacagatattccaatgtatcacaaagaacgtcatcgtcttacctactatcaatggtccagtatgtacttggcagttgctggaattgcttttatgattccaaagtttatttggagactttctcagtctacaaccgatatgccattgatatatttttgtgatactgcaaatgaaatcaaaattgaaactactgaaaaaagaagttccaaagtcaaagagatggctagatttatgcgctccaagatcacgactgtccatactccatccatattttcttgcatcagaatgtactctgtttattcaattgtcaagatgttgtacctcatcattgcaattgctcaatttgtaattcttgcaatttttcttgatcaagagaaggatatgttctggggatggactctctttatgaatcttcttaatggaattacctgggaaactactggattattcccacgtgtcaccttctgtgactttgaaatccgtgagactgccggaaacaatcgtgcggaaactgttgaatgtctgattggaatcaatgtatttaatgagaaaatcttccttttcctctggcaagttcttaatttcaacttttgacatttaatttgaaattctttaggttttggctcctatttcttatcttctctacactcgttgctcacatctacaatgccacacatatcgcgaagccctacat