Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK795.3   

sjj_ZK795.3 RNAi JA:ZK795.3
Simmer:ZK795.3
PF:GL1_6G2
PCR_productsjj_ZK795.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK795.3 Source_evidenceePCR776WS150 Sequence/Annotation Release
Overlaps_Gene ZK795.3 Source_evidenceePCR776WS150 Sequence/Annotation Release
Chunk_score Abs_score672
Max_abs_score672ZK795.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1255932812560445
Overlaps_transcriptZK795.3 Source_evidenceePCR776WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK795.31118aatttcagaatgattcgccgcgagaatcgtcttcgccgcgagtttatcttccgaaaatcgttggaggagaaacagaaaagtttggaggaaaaacgagagaaaattcgcaatgctttggagaataatacgttagtttttttgcttttatatgttgaaaaattcgtaatatacgaatattttcagaaaaatcgattataatctgcgaaaagacgcaatcgaattggcgaaaggctccgattggggaggacaggtaattttcgcgatttttgatgaagtttcaataatttttgttcagcaatacgaaacagacagcgagtatcgttgggctggagctcaagatccaaaaattgtgatcacgacgtcccgtgatccatcaagtcggctgaaaatgttcgccaaggagatgaagctcatctttccaaacgcacagagaatcaatcgtggtcattatgatgttaagcaagttgtgcaagcgtccaaggctcaagatgttagtggaaaattgaatatttgaaattttatcagcttttcagtaattttctaatatgaaattaatttttcagtcaacggatctgattatcttcacggagacacgtggaaatccagatggaatgcttgtttgtcatcttccattcggtccaactgcattcttttcaatggcaaatgtcgtaatgcgacacgatattccaaattgtggaacaatgtccgaacagtatccacatttgattttcgacaatttaaattcgaaattgggacatcgtttcaccacaatcctcaaacacttgttcccggtgccaaaaccggattcaaagcgaatcatcacattttccaattcagaagattacatcagtttcagacatcacgtctataaaactgaaaatgacggagaagtcgaactgactgaagctggaccaagatttgagctcaaacgtaagaaaattttgataaaagagcggaaattgaaacaattatgggcattttctattttatcgaagcacaattttgcgctgaaattaaacactaagcgagaaatatgaaatattcacatttcaaagtattttgattttttttttaatttccaaattttcagcctaccaaatcaagctgggaactctcga