Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK849.1   

sjj_ZK849.1RNAiJA:ZK849.1
PCR_productsjj_ZK849.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK849.1 Source_evidenceePCR765WS150 Sequence/Annotation Release
Overlaps_Gene ZK849.1 Source_evidenceePCR807WS150 Sequence/Annotation Release
Chunk_score Abs_score681
Max_abs_score681ZK849.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1418345214185733
Overlaps_transcriptZK849.1 Source_evidenceePCR807WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK849.12282aggcaggggtactgtagtaaaggagtactggggaaggggtactgtagggaggggtactgtagaagtggggtactgcaggcagggggtactgtagtaagggtgtactgtagaaacgggtactgtagagagaaataactgcagtaagggggtactgtagggaggggtactataggaagggaaagggtactgtaggaaaaggggtactgtaggagtactgtacctgatcatcgtccgccatcgaccgcttcaacttcccagtgaccacgaccggacggaactgatcacaacctccctgaataattccatttcttcaaattttttggcttttcggcaccaaccgtaatctcgagcccaagcccctgattgatatgctctctcatgagaatcacgagccgcggagagctctgccaatcgtctccgttctcaaatgcagcatcaccaaggtccgacgagttgatcctggaaaattttttgatgctccaacaagttcccacagaaatccatcacctaccgattgatgagccaaagcgtgttgagacgcaacaagcggttctccttctcgatctcgtcccacagtttcgatttgacggccgactcgatcgttgccgcgttgcgcaccaaatccatcatctgtcgcattgctgccagctcctgtaatgagtctcatgggaaagtgtggggaggggacatgatcatgtaaaaaatgatgatgcgtaggggccaaaaatctagaaaaaaagtgggggaaatgtcatggtgcatcgacaaaatgtttaggctgaagctttggcttgggttttggcttaggcttaggcttaggcgtaggcttagtattaggcttaggcttaggtttaggcttatgctaaagcttaggctgtgatctaggcttacgcttagaccaaggcttaggcttaggcttacgcttatgcctaggattaagctcaggcttaagcttggattaaggcttaggtttgggtgtaggctttggctgaggtttaggctagcaaaaaatgtggccaaagtggaaatcaccaatttttgggtaaccagagctacctgaacctctaccccacatggtgcatcgactaggtagaaccgtacccttgcgtagaacctggttgccatgagatgcatgacactcttcttggacacctcattgatatgcttcgccatccgctcgttacgccgcttctccacgttgagcttagcctccacaagacggtgctcctggatcctttccatattgtcaccgacttcttgtttctgaaatattaagcgttgaagtaggcaggtaggcacgaaagtgcctgcctgcctagtacttgtaggcacctaggtaggtataggcaggcaacattccctcaccatatcattgaaaatctgcctggaagtcgcgtctccctgatgattcgcggccagcaacaagtggaactgctggatgacgtcatcatgggcttcagctatggcacgaagctccacgagctcctggagacactcctcacgctccttgattgccaatttcttagcggattcttcactggcggacaaagtgcaaacctggaaaaatagtttgtgataaattaataaattatcgatttttctcgtcattgccaagttttcaataaccgagaaaaaggagttttgaagtaactattggaaacttttcaaattcccgccacagttttgtaccgggataccgaaaagtcgatacattatcgattttttctaaaatttttaaactaccgcccgaccgggattttaaagaaactttatactaaacaaaattcaaaccgtttttcgatatttcgagccggatagctaacaattttcacaaaaatcgatgatttcttactgattttcaaagcgaaatttttaaattcccgcctgaccacgcctacttttagtcagcggaatatcggagtgtcgttggagtgcgacgaaaaatcaataattttttgaatgacatttgccggaaaactgacatttttccaaaaaatcaatatttctcccagaattttcaaattcccgcccgaccggaagatcatattacctgcgtaaaaacattcgaaattgccttcaaatgggtaatccagtcgtccttctcatcggaagccagcgccttggacattgccgtattgaagacagcagtaagacgattgatttgttgacacgtcatttattgatttttttgcggaagaaaaatcgataaactcaaacaataaaagatttttatgcaaaaagttggaaaaagccaaaaaaaaatccaatgagttggaggaaat