Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK856.10   

sjj_ZK856.10 RNAi (3)
PCR_productsjj_ZK856.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK856.10 Source_evidenceePCR720WS150 Sequence/Annotation Release
Overlaps_Gene ZK856.10 Source_evidenceePCR821WS150 Sequence/Annotation Release
Chunk_score Abs_score758
Max_abs_score758ZK856.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1020824610209234
ZK856.13 Source_evidenceePCR35WS150 Sequence/Annotation Release
Overlaps_transcript ZK856.13 Source_evidenceePCR35WS150 Sequence/Annotation Release
ZK856.10 Source_evidenceePCR821WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK856.10989ggataatcgatctttgcaagctatctttatatttattttgcaagacgaaaaaataacaacttattcaacaataacaaaaagtaaaaacagtgtacccgttataatcaattaaaatttgattaaactggctcttctttaattttaacaggctgtctaacttcttcttgaggctgtctaatttcttctttgggctgtataacttcttcttgttcatcttgctcgtcttcaaccgcttcatcatcttcatcttctgctgcccaccatccaatacatcccaatccagtactagccatcgtacctttgatttccatagatttctctgtttttctctcttcgtgtgttaactctggtttgagatctctgcaaacaaatcaatattttaatttcgatgaaatacaaaatgtctcacttgaaaatgatttccgtcactcggaatctcacaatcttccctggatccatatacagttttgctggtggttctccatcttcctgtgcatattcccaataccaaacttgcccttcttcttcgaaaacatgaggttctggaagcttttccgccggtacaaaaatgtcttcgaagaattgaattgttagacaaagaccttgtcgtgatgaaccaatcactttggcctcaataacttcatcgacaaatggccgaaaaacgatcatacggaactgaagatttatttcatttctcaaatacgactgtacattgatttattaccttaactctcgctctacaatctccttcgccgggtaaaatgtacgaatcaccaatttcatttatatcatagacacaaatacagagaccaagatccggaataattttgttggcgagacgttcattgagccgttttttgataacaatttgctgatcagagctcaattgatgaggctgaatagccaccgtatcgtgcagtagagaaagaatgaacatactgtaaatattaaacattttccttttatacggcatcagtatcagcagatat