Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK858.1   

sjj_ZK858.1 RNAi (3)
PCR_productsjj_ZK858.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK858.1 Source_evidenceePCR847WS150 Sequence/Annotation Release
Overlaps_Gene ZK858.1 Source_evidenceePCR847WS150 Sequence/Annotation Release
Chunk_score Abs_score784
Max_abs_score784ZK858.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI91201679121135
Overlaps_transcriptZK858.1 Source_evidenceePCR847WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK858.1969tttcggagcgagaagacactgattcaccaggactgtcttcgtcaatgggaaatcaatcttcagaagaagatgaggataacggaattaataatcgaaacaattctgctgttcctgttcaattcaagaaacccttcaatgaagttgttgcccagccagcaagagaatcgaagagaacgcagacaaccagtgaagacaagatgcaagatcgtgagttttctttttttacttttatcgaaagtgatttagttttaagttttttttaaagttttacatctgcattgatattgtgcaattcctattttcagaattccatttcaatggatactcatatcctccaccctcacgatatgcagcaggtaccgcggcaccatcacacaaacatcgtaatgcgcacccgcaacggcagcgtccttcaattcgtaatctttcacaaggctctgatgggtcagatgaatacaatgttgaatcatggaacaacaatataagacaaggaagaagagcctcgtcgaattcaccaagtccatccagacagcagacgaatactagaaattgtggacccactaataatattccctacgattcatttcgctcacaaaacaagaattcgacgttagatggttcgaataattcatcagaagagccaataacaatgtatgccgatgttgttaaaaagaagtcttcgattacaacatcaaccaatacttccactgcagatgtcaacgtcaccaatggaaatccaatacccgcaaatggttggtaactatttaaaattttttaaagaattatataaaattgactgattttaggaataattccacaatctatggccgtggtcaacgttggaagaggatcctatagaaatgctcttacaacttcccccatgacgcctccatcagcacatacttcaatgcagaagcaacatcatttgcgtaaagataacgaatgtggtttcgacaacaactcagccac