Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK858.5   

sjj_ZK858.5RNAiJA:ZK858.5
PCR_productsjj_ZK858.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK858.5 Source_evidenceePCR855WS150 Sequence/Annotation Release
Overlaps_Gene ZK858.5 Source_evidenceePCR855WS150 Sequence/Annotation Release
Chunk_score Abs_score691
Max_abs_score691ZK858.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI91360129137653
Overlaps_transcriptZK858.5 Source_evidenceePCR855WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK858.51642aaatgttggcagaaaaatgaagattttctgaacttacatgaataagataattacgccaaagtgcccatttaaatggttcaatagttgaagatccatcaataacacgagcttcagaccgtagtacatctacgatgaatgtagttgttaattcaatctgtagatttatattcaatatattttttgttagatgagtaccaaacccaatcaattttcgtgagatgtgctgctccagtgagttcatcgaaaagctctccactccatacttggtaccaaaatgaactattttttagtgttttttctccatttttgtttttgatatccgattttgaatgatattcaattattggatttccttcgaaaaaactgaaaaaaataacaaattgatgttcgtgagtttttaaacaaaaagtacggtaagaggtctcgacacgacaagttttttgcgctttaaaatttcaaataattttggaaactattgtaattttcgaaggcacaaggcttttttcgcatgtaaaaaattttttcaaaccggaattgtaatttttgaagcagaaatgccttttatctaaaacttggtacaccctagcactttgagctttacctgtgaacttttttcgcatcaaaaatacgatctctaatcagacttccaacagatatagtttctcggaatgtaccaggacgagtggcagttacctgtaaaatttcaatttttgataatattttgaaacttatgtataagaacctgcttatctgcaacttttctcgagcatcccagtaggattacacaaacgagcatcaggaataatgatgaccagaactgaaaaatttaagtattttctttctggtatcatcaattaggaaaagctgtaaataattaccaggaaatgtttccacgtgtgacgtcgcttttttaaacgagcactacgatttccgatgactgttgagacgatggcagtgagaaaaatggcacgaaatacggtcgtttgggctagtcgaacctacaggatcattttatattcattgaaatttcaagcaaggctttcatattattcagttgctcgaaaatatcgaaaatcataatattttcaaaaaatgtttagtcagcgttttagcaaattggcaaattattcaaaaaattgaagtagttttctgaacgatgtgtactttggcaaaatgcacgcgagtaggtatgaggcaggcgggtaggcatttcggtacataatcttttttaaagttttaccataatgaacattgatgagaaactggccatccagatataactcagctcacggctttgtccgccacattgaccaattatgtagatacctgaaaaatgaaaatctccctatatgaacaacttaaaaaatggaacacttacctgcagtaatacctaatgcaacaacacaaatgaatggaataagattgatatccgtccatccgaaggttacggtacatgcaagccacgtggcaagaccaatgtatgatccatagagaacagaatagagaaaacgagtaaacgagaaatcaacaaatttcgattgagaagcttgcattttaccatttctgaaaaaggtattattttaagatatttaaaacataaaatcttcagcaaaacaagaacgaacttccacttttccttttc