Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK863.6   

sjj_ZK863.6RNAiJA:ZK863.6
PCR_productsjj_ZK863.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZK863.6 (3)
Overlaps_transcript ZK863.6.3 Source_evidenceePCR497WS150 Sequence/Annotation Release
ZK863.6.2 Source_evidenceePCR499WS150 Sequence/Annotation Release
ZK863.6.1 Source_evidenceePCR504WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK863.6934gtctcttcgtctcaacaatgcttgcactccgtcacattttcgaattgtcggccgatatcggtatttagataaattcagtgctctcctttttttctccattttactttcatcaatcttttttaaaaatcaatattcagcaaactattgaaaaattaattcaaaaaacacgactggtcggaagttatttgcataatcaatagaaatttcgttttccgctcgctgtcagtgttttgtcctgtttgtatttcccagtgcacttttcgagtggctcaagtttttatctattttcctgcaaacttgcatatattgttttcttccagaagcctttgatatctcaataattttatacttgtttcagaaatcgagcaaaaaccaagatggctgatcaaaccgcgtctgccgaggttgctgtaagttattaaagtccattttctattttactgggaaacaatattcaaaataatgtattcaacacatttgcaattttagaccgagaagatggacactgctgaagctccagctgctgccccagccgcatctgcagccgctccagcggaagcagagagcaacgagaatacgacagttccatcaaacgtcttgtctgccaatggaggacaacagactggtaatcaatcggcaccgcgcaacacaagtactgttccaactcgtcaatatctcgactcaactgtcgtaccaattcttctgcaaggactcggtgctcttgctaaggatcgtccagaaaatccaatcgaattcctggctaacttcctgttgcgcgagaaagaccgttacaacgctgagaatcaaaacccagccggccaacaataaacattaaaatgacacatattgtgtgaagaaccggcaatattcccttctaattttcgtatattacattttgtaacttattcgtattccttcaaatttaatctgccac