Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_ZK892.5_b   

sjj_ZK892.5_bSequenceAAACATAAATGGGCCCTTCC
In_sequenceSUPERLINK_CB_II
PCR_productsmd_ZK892.5