Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_ZK970.1_b   

sjj_ZK970.1_bSequenceCATTGTTTTGGGCAGGAGTT
In_sequenceSUPERLINK_CB_II
PCR_productsmd_ZK970.1