Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK973.j   

sjj_ZK973.jRNAiJA:ZK973.j
PCR_productsjj_ZK973.j
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK973.5 Source_evidenceePCR1089WS150 Sequence/Annotation Release
Overlaps_Gene ZK973.5 Source_evidenceePCR1089WS150 Sequence/Annotation Release
Chunk_score Abs_score900
Max_abs_score900ZK973.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI43596214361699
Overlaps_transcriptZK973.5 Source_evidenceePCR1089WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK973.j2079atggctccccgatataatactgtataataagtaagtttgagtttccgaaaaaaaatagttgattcaaatctagcgcccacggaagcccgtgggtatcagagaccacacaagtgcatgtttcattcgaaggacgtgttacatggcaacctccagtagtgtatgatgcattttgcaacattgacattgaatggtatccgtatgacttacaaatttgtgaactcaagttcggctcatggacctacggaggatcacaactcaatttaatacatgtgagattaaaatcaaacttatttcagtaatttttagtattaaagcttactactgatcaagctaatgaaagtactgatgcaaccggcgataatgtatggaaagtagagagaggagttgatttgagcaattatcaggtaagaactacatatctacttataacaaaaaagaacgaactataggagtctgttgaatgggatttgctatcagtagaagggattcgtcacaaaaagtggtacccatgctgtgactatccgtgagttaaagaacatataatcaatttatacagtaatagcttttataaaaatactacttttataatagctttataattcaacaagaatttaatcactaatttatctgtatctactaaaatataaattcctatatatctttcctctccaaattaatacttttcagatcaattgatatcacgtattaccttcatattcgtcggaaaaaattattctacacagtcaacatgataattccatgcgtctgtcttgcatcgatgactctttgggtaacatctaaatttttatctaaatttgtatttggacgtgggctaattgtagtctattaatttatataagtaaacaattcggcaaatcggcaaattgtgccggtttgccgatttgtcggaaattttgattttcggtaaattgccgatttgccaaactcaatttgccggaagtgtttaaagggatttttataggacggaaacacaaaacatttttgaattttttttttaattgcctgtttgccgatttgccggaaattttcaattctggcaatttgccgatttgccggaaaaaatcggttgctgtccaccaccggggtagataattgcacacctttgaaatcgcttatgttttccaggtattctatcttccgtgtgaaagtcatcaaaaaatccagctttgcatttccgttctcgtcgctcttacactctattttctaatgttaattgatattattccaccaacaagtattgtgactccattgattcttaaatatctgagtttcacaatgattatggtggcgctttcagttacttgcaccgtatttgtaagtttttataattttttgaagatggtgaatcgtcagtatggaataccataattaaaccatacaacatgtttaggtaaagttttggaaagtgctaataaataaaagttagccttaatgagaaatttagaatattgctacaattttgaaatataatcgtttcaacttaattttgaaagcttccaaaattatgatctatcaaatctgagaattttgcactttttgacagaaaacgtgttttataagatttttagatatattttctaatgtgatttttggtaattttagtcaccttgaaactgtaatactataattcagattcaaaatatccactatcgtgcttattaccaaccgatgcccagatttgtcaaacactggttcattgaaaagctcgggaagaagcttctaatttcaagaaaaaccgaacaagctcagtatcatagaactgctcagcatgtcaaggttttgtaatatattcatgagaaatgatttattttgctacttttcagcaagtcaatgcattatcagccatgaatattttggagaagcagtttcagaagaccttgtttgagctggaggtaaatcactttatggcatattttttgctgaagaatatcaatttcagatcgccacgatggccaagaaaacagtgacagccgcccctaagacagttaattcaatatttctagaattaccaatgatgaatcgaagtgtttctgtgaagatacgaaaaccgtctgtgaa