Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_ZK973.l_f   

sjj_ZK973.l_fSequenceCCACTCTTAAATTACCGCTTTCA
PCR_productsjj_ZK973.l