Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: smd1_B0273.3_b   

smd1_B0273.3_bSequenceaacttctagcttcgggctcc
Length20
In_sequence B0273
SUPERLINK_CB_II
PCR_productsmd_B0273.3