Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: smd1_C06E7.1_b   

smd1_C06E7.1_bSequencecattgtgtccaaagtgtccg
Length20
In_sequence Y105C5B
C06E7
PCR_productsmd_C06E7.1