Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: smd1_C25G4.4_f   

smd1_C25G4.4_fSequencegatcgtcttgtggctccatt
Length20
In_sequenceC25G4
PCR_productsmd_C25G4.4:2