Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: smd1_C31C9.1_f   

smd1_C31C9.1_fSequenceatttttccagaacaccaccg
Length20
In_sequenceSUPERLINK_CB_II
PCR_productsmd_C31C9.1