Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: smd1_C47E12.1_f   

smd1_C47E12.1_fSequencetcgacattgacatgttccgt
Length20
In_sequenceC47E12
PCR_productsmd_C47E12.1