Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: smd1_F28F8.7_b   

smd1_F28F8.7_bSequenceattttaccgccgtgaacaag
Length20
In_sequence F28F8
Y73B3A
PCR_productsmd_F28F8.7