Oligo: smd1_K07E8.10_f
| smd1_K07E8.10_f | Sequence | gattagcggtgatgttttgctac |
|---|---|---|
| Length | 23 | |
| In_sequence | F18G5 | |
| C17B7 | ||
| K02E7 | ||
| K07E8 | ||
| PCR_product | smd_K07E8.10 |
![Adult](JavaScript:void
window.open("/cgi-bin/rnaidb/popUpImage.cgi?imgName=N2wormfinal.png",
"RNAiDB Help","toolbar=no, location=no, directories=no,
status=no, menubar=no, scrollbars=yes, resizable=no,
copyhistory=no, width=1000, height=550"))
 |
Please provide feedback if you are experiencing any difficulties with this website. |
| smd1_K07E8.10_f | Sequence | gattagcggtgatgttttgctac |
|---|---|---|
| Length | 23 | |
| In_sequence | F18G5 | |
| C17B7 | ||
| K02E7 | ||
| K07E8 | ||
| PCR_product | smd_K07E8.10 |
|
Please provide feedback if you are experiencing any difficulties with this website. |