Oligo: smd1_T06D8.1_b
| smd1_T06D8.1_b | Sequence | cctttgagagctcagttggg |
|---|---|---|
| Length | 20 | |
| In_sequence | SUPERLINK_CB_II | |
| T06D8 | ||
| PCR_product | smd_T06D8.1 |
![Adult](JavaScript:void
window.open("/cgi-bin/rnaidb/popUpImage.cgi?imgName=N2wormfinal.png",
"RNAiDB Help","toolbar=no, location=no, directories=no,
status=no, menubar=no, scrollbars=yes, resizable=no,
copyhistory=no, width=1000, height=550"))
 |
Please provide feedback if you are experiencing any difficulties with this website. |
| smd1_T06D8.1_b | Sequence | cctttgagagctcagttggg |
|---|---|---|
| Length | 20 | |
| In_sequence | SUPERLINK_CB_II | |
| T06D8 | ||
| PCR_product | smd_T06D8.1 |
|
Please provide feedback if you are experiencing any difficulties with this website. |