Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: smd1_T06D8.1_f   

smd1_T06D8.1_fSequenceactgaagcttccggtgaaga
Length20
In_sequence SUPERLINK_CB_II
T06D8
PCR_productsmd_T06D8.1