Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: smd1_T21B10.7_f   

smd1_T21B10.7_fSequenceatctcgacgagggtttcctt
Length20
In_sequenceSUPERLINK_CB_II
PCR_productsmd_T21B10.7