Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: smd1_Y75B12B.8_f   

smd1_Y75B12B.8_fSequencegaaatattccgattcccaaagtc
Length23
In_sequence C41G6
Y75B12B
PCR_productsmd_Y75B12B.8