Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: smd2_C47E12.4_b   

smd2_C47E12.4_bSequencecgcattttaaattctggcgt
Length20
In_sequenceC47E12
PCR_productsmd_C47E12.4:3