Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: snp_pkP4086.3   

snp_pkP4086.3SequenceGGGAAGTTTTGAATGTACCCG
Length21
In_sequenceC25G4
PCR_productsnp_pkP4086.amp