Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: [cgc4895]nud-1   

[cgc4895]nud-1RNAi[cgc4895]nud-1
PCR_product[cgc4895]nud-1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53A2.4 Source_evidenceePCR963WS150 Sequence/Annotation Release
Overlaps_Gene F53A2.4 (3)
Overlaps_transcriptF53A2.4 Source_evidenceePCR963WS150 Sequence/Annotation Release
WB_DNA_text[cgc4895]nud-11010atgtctcaatatgagcgattcgactcggtgctgctctccatggcccaacagctgagcggcggagtgcctgaaatgcttgatgtactatttgaatttctttcgaggtaagaaattttttcaaagtgcttaataaatacatgttttgtttcagaaagacggatttctacagtggcgctggtgtcgatcaagcccggacccttctcctcgaaaaattcgataaacacggtggaaaggctatgaaggaagctgaagaagccaagaaacggaaggaagagcaggagaggaagcttgctgaacgaagagctgcacaaaaagctaaggaagaggaagagttccgaaatgcgaaagtcgtggaagtcactgatgaggaagcggccgcgtttgaaaaggaacaggctaaaaattctgttgaaaatcttgaaaaattcgtcgataacgaaggagaaacatcgaaagacgctgaagtcgaagatgaggacagtaagctcatgaaaccaaatagtggaaatggtgcggatcttgccaaatatcaatggactcaaacactccaagaactcgaggtgaagattccaattgctgctggatttgctatcaaatctcgtgacgttgtcgtcaaaatagagaagacttcagtatctgtcggcctgaagaatcaagctccgattgtcgatggaaagttgcctcacgccattaaagtagaaaattgcaactgggtaatcgaaaacgggaaagcgattgtcctaactctcgagaagatcaatgatatggaatggtggaatcgattccttgattccgatcctccaatcaatactaaggaagtgaagccagagaactcgaaattgagcgacttggatggagagacacgtgccatggtcgaaaagatgatgtatgatcagaggcagaaggagatgggtcttccaacgtctgatgagaagaaaaagcatgatatgctgcaacagttcatgaaacagcatcctgaaatggacttcagcaatgctaaaattggataa