Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: [cgc5260]:cdc-25.1   

[cgc5260]:cdc-25.1 RNAi [cgc5260]:cdc-25.1:1
[cgc5260]:cdc-25.1:2
Sequence[cgc5260]:cdc-25.1
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneK06A5.7 Chunk_score Abs_score2122
Max_abs_score2122K06A5.7
Specificity_index1
Rel_score1
WB_DNA_text[cgc5260]:cdc-25.12545acagtgtgctagggggcttcattttgaaagaaaataaaaatgatcaaaagaatgaaagtcatggtacagtaaatgcgtggttgggaatggcgaaagtgatttagagagttaaagatcctcagtgactgagtagtttgtttgacaactattagatagatgacctaggcataaggcgtgagttaaaaaaaaaacccttcagtcttggaagcgtattgcaatgaagccacattgcttagagaccaagaagggactgatttaaaagaatgggttggtagaagaggaaccagtcgaaacggagacctgcaaagtgtgactcaaaatagaaaaagaaacgagaaacggaaaataagttaagaaaaagatgggatgaaaattaacaaagtttaaacagaatgataaataaaagtaatgggagagagggtgctattattcggcgtcgtcagaaatcgatgagaagtcaagaattccacaaggaatctgatgacccccttccccgagtgggagatgttctcctgctggtgtggttgacgatgattctgacgggcgatctgggaaatccggtgtgatcacctggagcccaagttgaacaatgcgctcttcagctaggttgactatggaagacgcatttgaagcatttgaacttatattgcgctgatagataagagctgcatctaaatcattctgcaaaatgaaaaaattatactgaaatttttaatgacagtatttacctccgattccgtgctttgaatatcgaacgcagaaacccatttgggtcgtctctcatcatccaaaccataaagaatattctccatgctgcttgtcttgcttccagtagaggttaaagcactagacgaccttgataacatctaaaattagtaaagttgaattgaagacgattttaaactaacgttcaaagaagaattatttcttcgaattacactacgagtacatcttttcttcttttcctcgcgatgactggtttctccattaggtttcaacgaagccattgaatgatgccgttcgagacgagccgatttaaattccatcgaaaatgaactgtgtgtcattggaatgtaagaacatggctcacatatctgacgacattcagcagtactccacaacgatttatagccatagtccaacaaatacatttccggatattcgacatgtggataacgaagttcattcaacacgcggtcaatagaacgtacagcatgagccctaaaaatcagatattttataaaataaataaagaaataccaccgacattgttggcccccgtttctgactgtattcgcaatagaagatcggaacacgattttgaaaagaactggcttcgccgttttctgggaaaaatattggcttgatcttgtcatgacgaaacaaattgatagctcctttcacatgaccacccttgtactcaaatggaaaacgacagtcgactataatgtatttcttatcgaaatcatctccaagacgttgaaattccaagagtaaagtagtaggtgagatactccggaatgcttgtgactctctctgtggattatcaacaccgggaagagtgtacttctaaaaagtaattttctggataacttcaaaaaataatcgaaaaagtataccacttctaacgttggaggaagttcagaatcaatctcaccaacgctcatcgcacgcaaaatttgttttggtctctcctggaaagatccgttgcctgacgtatcggaagtttttcgttcaaaaaacatcggcggtgccaaatcccataacgaagttgctgttcgtggggcaggttgagcgaaaattgatgtattctgaacttgagagtttctgacgttgctctgctcaaagacctcatcgtcttcatcaccgaatggatcatccctcgggttattgagaccattatagcgacaagatttgtcactctgtggagcaacaagagacaaattccggcttctcttgcgatccaggagcgtgacgctgggagacattgaactggaagttcttttccgatgattatccgttggtctctcgctcataactcttttctcatattctgagtgatcgagagaatccaaatcaaacaccgtcttcatcttacgccctgttggtgtatcatagttgtagctgaaaattgtttttttttggaagtcgcatgatgggaatatacaaagaagagctgcgtgatgagctgacagacgagtttcgttgtaaaattgaaacgaaattggaacagtctgtgagggctacacgaccagattccagtttgctaaaatccacatcttcctcgggtgatgcatctgatttgtcgctacagctagtcattgagacacctgaataagaaacaaatattaattaagccttccatttacatgacaaaccagaatcgcgggagctgccatcttcttcaaataaggttttcggtgattcgttgataccgtttgccacatcaaccacattctcgatgatatttacattattttgatcctcatatattgctttttccccggtggtagccatcagagatgcacagccctcaactaaaaat