Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:10-c1   

Cenix:10-c1RNAiCenix:10-c1
PCR_productcenix:10-c1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC25D7.6 Source_evidenceePCR519WS150 Sequence/Annotation Release
Overlaps_Gene C25D7.6 Source_evidenceePCR519WS150 Sequence/Annotation Release
Chunk_score Abs_score477
Max_abs_score477C25D7.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1505994615060517
Overlaps_transcriptC25D7.6 Source_evidenceePCR519WS150 Sequence/Annotation Release
WB_DNA_textTH:10-c1572cggaacggagctagattgaggctcttccgatgttgccatgtcctcgttatcgctctgatcctcatcatcgtcaccatcaattcgtggagctcgcttcttcttctcatactcttgacgagcctttggcttctccttgaaacaggcaaagtggagcagattgtaagctttctcagtatcctctcgttcgacttttttcgagaatcttgccttcgcgatagcagttgacaaacgaatcaatgtttcgagttgacgagcggtgacaggcattgttcgttcttgatcagttttggtgatatcaaatgaacgaatatcggcatatacttcagaaatgtactcagtagcttcatcggtgagttttggttgaactgatcttgccaaatggatgtactttctcatgaagtccattgtcaggattttcgtgctgaaatagagaaattaattaatttatattgtttttttataaaagaaactcactcttgaataccagcccattgggtattttcctcatagatcgagctgctcgccttcttagtctccatattgattgtactgatcgtctcaacacctccacc