Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:104-d7   

Cenix:104-d7RNAiCenix:104-d7
PCR_productcenix:104-d7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55A11.1 Source_evidenceePCR530WS150 Sequence/Annotation Release
Overlaps_Gene F55A11.1 Source_evidenceePCR533WS150 Sequence/Annotation Release
Chunk_score Abs_score449
Max_abs_score449F55A11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1176611711766937
Overlaps_transcriptF55A11.1 Source_evidenceePCR533WS150 Sequence/Annotation Release
WB_DNA_textTH:104-d7821cgattattgtgtgccaccagctttctgcatttgttcctggtgagatcttgcttgatcttctcgaagcttttgtgctttgaggaactctccgtagtcgatgaagccatcagcattgaaatcgtcgtccctgaaaatattcagtaaagtatttttttaagactttgaatattttagtgctttcttatgctaattgctagcagtagtctctagaaaataaattaattaaatatatatctcactttaaaatactatcaatcatcgtctccaattcaacttcacttgggagtggtggtggctgatgattggcattggcattattttgtgtatgctgtggtcctggattctcggcatggaaatgcgttattgccttaatcaactcgactccatccagtttcccatttttatctaaatcgtgcatattgaaataatggaattgaagttgttctggcgtcatgttagcagttgggtccacttttccgtccaaatgttcttttatgtggctgaaatgttttaaattaattttgaaaattgttattaaaacttactgttcatctctggcctgttctccaccaaactgctgttgcccaggctgagcatgttgagcttgttccgcttggccaccctgatttattcaatacaatttacaaaattaaagaagctttaaaataataaaaatcactgtatccagattgtttttcagttcaatttctagcgaaaataattttcttattattctttacaaacattgtttacctgttgtggttgctgttgattagaaccaggaaactgctgtggttggtgggcaaaggaaccaagaatga