Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:105-g8   

Cenix:105-g8RNAiCenix:105-g8
PCR_productcenix:105-g8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY75B12B.4 Source_evidenceePCR508WS150 Sequence/Annotation Release
Overlaps_Gene Y75B12B.4 Source_evidenceePCR508WS150 Sequence/Annotation Release
Chunk_score Abs_score466
Max_abs_score466Y75B12B.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1519077215191629
Overlaps_transcriptY75B12B.4 Source_evidenceePCR508WS150 Sequence/Annotation Release
WB_DNA_textTH:105-g8858atgaagctctgcatgtgacgggtatctgcgaagcggttcgtcaagattagctttgcttatccgctaaaaaataatcttttcgtacaaggacaaaataaaatctgcacaaaatacatcgtgatgtgctaaaaatggttaatgtgaaagtcctagaaatagaccaataaactttataaattttgactggtctcgaagccatttagtgtactgtaggtgagagcattgctcagcttaaattgtttgtttcaaattcttcttcattgttcaaattaaatttatcacaagataaaatgtctggaaaagacaataaaggatcaattcgttttgagattcaaaatttttctggcttggcgaaggcgacggagcacaaaccagtgcaaattggacacgtagaatggttagtgaattttaatgaaacaaaaaatgttctaaattatttaaaatattatcttttaaggattcttggagcattcacaagcacttccgacgctacgaacaatgctaaacatctcggaattcacctgaaatgcaacgaggaactgcgcagcaacttgtggtcctgcgatgcgtcaattcgtttttcacttctgagactcaattcaaacgaggatgatgacgcgttttcgatggagtttcagcaaaagttcgacgacttgaacaagattgtggtggtcaacaattttaaaaattgggaggaagccatctgctacgataatcgatttgtgctcgataagcatgccgttcttgaagtccaaattactgtcaacaagattgccggaattcatgagaggattatcgagactttcgatcaacccaaggaacatcttaccgatgttgtgctggtgcttgaaggaaaac