Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:11-b8   

Cenix:11-b8RNAiCenix:11-b8
PCR_productcenix:11-b8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC36B1.3 Source_evidenceePCR509WS150 Sequence/Annotation Release
Overlaps_Gene C36B1.3 Source_evidenceePCR509WS150 Sequence/Annotation Release
Chunk_score Abs_score446
Max_abs_score446C36B1.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI87289288729645
Overlaps_transcriptC36B1.3 Source_evidenceePCR509WS150 Sequence/Annotation Release
WB_DNA_textTH:11-b8718tacatttcaggtgccaaccatagctattgattgggttcaaattgaaactaacacttctgtcctccacgacgaatttattgcacatcgcatgggtttgattccgttcatatctgattatcatgtcgaaaaaatgcaatacaccagagtaagatagggttgaatctttcacaactttttaaatgttggttttaggattgtgaatgtgccgagttctgcgatgagtgttcgataccgttcattctgcagatgaaatgtaaagatgaagctactttggctgttactaccgagcatctaatgccaatgcataatttagacacggtaaatttaaaaaaatgcaactcatttttttttaatggagtgaattaaatttcaataataatattaataacgtttaaataaaatcgatgagcaatcttattagggtccgtacttcactacatttgataaatatttgaattggaattttacagaccgtccgaccagcttgtggaaaagcactacgtgagcgtggatcgacccgtgacgaatttcacaacagagaagagattctgattgtaaaattgcgtaagggacaagagcttaacctaaaagcctatgttaaaaagggtttcggaaaggaacatgcaaaatggaatcccacctgtggagttgcatttgaatatgatccagacaatgctctccgacatacaatttatccgaatgttgaggaatggccaag