Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:11-d1   

Cenix:11-d1RNAiCenix:11-d1
PCR_productcenix:11-d1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F23B12.8 Source_evidenceePCR535WS150 Sequence/Annotation Release
Chunk_score Abs_score493
Max_abs_score493F23B12.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1445707514457654
Overlaps_transcript (2)
WB_DNA_textTH:11-d1580aatgccttcatggaatcagccatcgaagaacaggcagctctcacatgctccacattcttcttactttcattcgttcgtgcttcgtagctatcacatgtggtttgatggagagtagataccaatggtttcatatcttctgtgaagtcggatacttgtttcttcacctcatccaatttgtcaactaccatctgagtgaattcttgagatttggccgagtatgacttgtaaaaatcatcacacgtcttcatgactgtttccaatctgattcgattttccatcgatatggcagtcatgttgtcgatgactttcttctccgcttccgacgatttcttcattatgcatatggcatgtgtctccatatccattgccgtactctcaatgtctcgatgagcagattccattgatttgacatgagggcaaatattttccgacaacttctttgataacagatcaccatcagctttcagcgagttcgtcagctttgaggtcgtgtcgatgaaatcactcatctgaaaaaaaacatctaactaagaatgagataatcctaatattacctttttcgagaagtggtcaatgacga