Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:116-e4   

Cenix:116-e4RNAiCenix:116-e4
PCR_productcenix:116-e4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY48E1B.7 Source_evidenceePCR561WS150 Sequence/Annotation Release
Overlaps_Gene Y48E1B.7 Source_evidenceePCR561WS150 Sequence/Annotation Release
Chunk_score Abs_score540
Max_abs_score540Y48E1B.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1357761413578237
Overlaps_transcriptY48E1B.7 Source_evidenceePCR561WS150 Sequence/Annotation Release
WB_DNA_textTH:116-e4624cgtaattcagctcccaaacccctgattttttgcagaaaaatgaatctctacgacgtgctgggcagcaaaatgtacctggaagacgacgagaaggggggtccgaaacgtagtcgaatcgacgacgatgaagcctccttctcagacgtctatcatcaccaccaaccaccaccaccaccacatccgagagccggagcaccaggagactatagatatgctgtagatgactacagagagtatacagtctatccaacaagtggggggccgaagcagcagcacggcggagcccacaactcagttgatagaacatgtcagggatgtggaatgatgttgagacgcagtgtattctatcatcatgcgagaatgattcgtgagaaaggagcttgtaatttatttacaccgcaacggttcccatgcacacagtgtgatgctcggattggaactcttgagaagctctgtcagcatatggaacagattcatcaggcgcccacgcaaattaagacgatggtttttacgaatgaagaggattttaaacagtttcgtattgagctcgagggaaaaggtggcaattttcggatggctagaggaaataagaagaataaggtgcggaggagttgaggaagcatg