Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:117-e11   

Cenix:117-e11RNAiCenix:117-e11
PCR_productcenix:117-e11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F35A5.8a Source_evidenceePCR797WS150 Sequence/Annotation Release
F35A5.8b Source_evidenceePCR811WS150 Sequence/Annotation Release
Overlaps_Gene F35A5.8 Source_evidenceePCR826WS150 Sequence/Annotation Release
Chunk_score Abs_score644
Max_abs_score644F35A5.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX38012053802896
Overlaps_transcript F35A5.8a Source_evidenceePCR797WS150 Sequence/Annotation Release
F35A5.8b Source_evidenceePCR826WS150 Sequence/Annotation Release
WB_DNA_textTH:117-e111692aatcggcgagagaactgaaatatttgcatgacacgtacattcactacaacgaaataaaaaaagcagtggctaccaaatgaattgctagcgggagacgcatgcgacatgaaaactaatgagcctaattttgaaagagagacttacccgctcaattcccgctgcaaatcggccatgagttgatgagactgagcatagaaagacatttgtgcctcgacaaaatcacgaagacacttcaactgattgttctgaaaatttttatacattttaaattggaaaaatcccatttaaaaaactaacgtgtgcggtttgaattccttctagcaacaatttggtaatctctgattgcttgtcaaactctgcttgagcaacacgcacgtccgcctctgcctgaaacttgtgaaacgtttcaaaagtttcaaaatataatgtttagatatgtaactaaaagtttataaagtacatagaaacgggaggaataaccagacaataatgaaaaccaacagtgttacaacatttctgaaacaaacctgctcaattgtaaaccctccagaggttttactattcgtctgaaacagttactttcttttttagatttttatttttagaaaattaatttttcacaaattaagaaaaaaatcactcaccactgtctgaagatctacagtttttgctttcttgagtcggcttttacatgcatccaaatcgagacgcttgctgttcagcacttttctttctttctgaattagatatttttattgaaagcggaaatatatttatggcgcagctggcctgagggcaagaataatttgaaatgcatttactaaatttttttagcaagagctcatgaatagtgcagcttggaaaagaggagtctctcacctgaattgttttcatgtcgccttccaagaatcttctaatagggagcaaagtatttgtggccgcttgtccacacaattcccgttccgcttgcccaagtcggttttccgtttgagccactttgaggagtgcagatcctgaaattattgagtattatatgtcttatgaggaaacaaattaaataactaaccatatggagtggtctctccgaactgctctccagcttcggtcatcgctgttgacaactgctcgagattattttgccgaatagcaccatcctttttcaattccaatttttcatagaatacttcttccatgcgaacggctgcaatagataagttcatttctcaggtctttttgcaaaacataatatctttttcgtgaatactaactgggatttggctgcaaataaccctcaattgcagagaggagacggcgagtatgatcttctgtcttgtcggctcgctgtagaaggttctcaaagtgggagtccagttcggtgcgctctgctttcaggaatgtttcttcggtgagctggaaattgaattttaaatgtatgggatttcgaaggaattcgtaaaaaaatgaccaacctgcttagctctgctaaagaatcctccagcatcactggctatctttttgaagttaaaatccatactgagttttcaacaatctgaagtttatcaaaattattcacaaaagtgcgagaaaaaacaaaagaatggaagctgttcgaacggatctgtgaggggtgccccgactacgacggacgaaattactggaaaacggggctgctggtaaagaagatggcggtga