Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:117-h11   

Cenix:117-h11RNAiCenix:117-h11
PCR_productcenix:117-h11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF37B12.3 Source_evidenceePCR899WS150 Sequence/Annotation Release
Overlaps_Gene F37B12.3 Source_evidenceePCR1046WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII90399179041572
Overlaps_transcriptF37B12.3 Source_evidenceePCR1046WS150 Sequence/Annotation Release
WB_DNA_textTH:117-h111656gaatggaccgaacaagaggaaaaaaaacaaactagctcgcaacaaaaaattaacgtttgatatctatgaaactgtgatagattaaagtaaaaggagataatgaaaggtaacggcaagtggaaatcgaggaatgtgcgaacttagaaattactttccaacacgaatatcacgttgactgaaagcttcaatacagtagtcgagtcctcgtcgtgagcatggaagccgtggtgactgcaggaattcagttattcgaagattccaaggaggataaccgcataatgtaggaacatttccaattcggagtaaaaagtctgggtcactcaaatgaaacttttcttctagaattttcgatactttctccacagtaatcggttcgtcgtcacgacataactgtaaaaaaatatgttacgttaaatatggctcgctccttaacttacagttttacatgtctccacaagcgcgtctttgcccattttccttgataatacgttaacctgaatactagcaagatcgtcagaatgtacaagtcggccatcgcagtagagatcagctcgctgaaattgttcatattcgatgaattgtatgaggttacaagcataccgtgaaaatgcgacaagcctgttcaatctgactaatttggttgaccaggtctccgaatggatcatagattgacaattgtcgaatttccgcagaaacacaactatccattagttgtattacttcggtctgcaacaataaaacgttgaaactttttttcttgaatttacgttttttttaaattttgctcatcatcagaaaaacgttttctagacaagattttgtgttaaatacaaaacatgtacgctttttaaatttctatcgacttttgtatttttcacatgatttgtcaaaatgtatgaattttgcggttataaatactttttattgaaaaattataaaaaattgataaaaattccggagcaacaggaattcagcacactttgaaagcccataccttatggaatttaataaaaatgtgtggctgtatttttacgcaaaatttgcaaaattttcagtctgggtaattttttaaaaactagaaaaaatacagttaaatttttttcaattaattaaattaaaaaatttagatattatcaaaatttataaactgacatgtgaaaactgctagttaaaaaaaattaggtttaatttcaagataaaatgttaccaagtcgatgagacgctcctccgtgaaacagacagctaaatgagtgggaatccgtattctcacattgtccgttttcctattcttcatggcgatctgtgcccacaacggtgaatatcctaagaagttgcatacgagcatcacgagccaatagacagcacgaactgctccaacacagatccaccctacatctagcatctgaattcgaattatcatatttctgagatacaacttctcaaattgattttgcagaaaaataatgtttggcttaaaaaaccgatacagtatgtagaaacgagaattttgtaaatacagttcattcgtatatgaaaaaatgagataatattcaggaaaagccttttcacttttttgaaagcaaacgacatgtttagccgaggcttttgaggaaagaaaggctaaaaagggagagatgaatgggaaaagacacggaa