Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:120-g6   

Cenix:120-g6RNAiCenix:120-g6
PCR_productcenix:120-g6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST03D8.2 Source_evidenceePCR474WS150 Sequence/Annotation Release
Overlaps_Gene T03D8.2 Source_evidenceePCR474WS150 Sequence/Annotation Release
Chunk_score Abs_score390
Max_abs_score390T03D8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV2083573320836753
Overlaps_transcriptT03D8.2 Source_evidenceePCR474WS150 Sequence/Annotation Release
WB_DNA_textTH:120-g61021gtcgcgtttcttttaatcgcttatatgagtgtaattaaaacaaaaagtaattaaaaactatcctatttttctgaaagaagaataaattaacaaaatttcggtatttttctggattttcgttcatttaaaatactactatttctaaattatgttttattgaagataacattacgctgtccacattactattcctttcagttcaatattttatcatttttcatctttccgatacgtctgaaggttttagcaagaatttcagtgaaaaaaagaggtaaacgcgcgccaccgtcacgcgatagagatgagagacgcgcagacgacgagacggttatcttttaagctttttgtttccgggaggccatgaaactttaaaaatctctattaaattcctattttgtagatgttacctcgtcttggaggatttctagccgggttttccagtacaatcagctcatttcttccgaaaacgaccgcgtctacactcttcacacatcaatcatcgcaattttcaactagttttcctgcttggagaaacaatttcttgcaggtaattcaatcttaaatcatgaagaataatactaaaaattgcagtttattcactaccgaaatggcccaccaaaacgacgtgctcgcagtaaggataagagcgcaatcagtggatattctcattacaaaggaattgtgctgaaaagtttccatttttaattctcttgaactaatcaataaactagatattttcagccgtgattcgtcaccccaaaaagccaaactctggaaatcgaaagtgtgcaattgtgagattgtcgactggagcagaagtgtgcgcgtatattccgaatgtcggacacaatttgcaggaacattcacaggttacacagtctcttttcgcgaaaaaaaacgttttttttttacttttttacaggtgctggtaaaaggaggacgtcgacgagatttgatttctgtcaaagccaatattgtgcgaggaaagtacgattgtgcaccagcaggaggacggaaataa