Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:122-b5   

Cenix:122-b5RNAiCenix:122-b5
PCR_productcenix:122-b5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06A1.5 Source_evidenceePCR404WS150 Sequence/Annotation Release
Overlaps_Gene C06A1.5 Source_evidenceePCR418WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII1057894810579696
Overlaps_transcriptC06A1.5 Source_evidenceePCR418WS150 Sequence/Annotation Release
WB_DNA_textTH:122-b5749caaattgcctctcacaacgacgttccaccgttacgccttgcgtcttgtttaacgtaaatccacctgaacaatttcgtagaaccaattttctttcttttgcttttttgcttttcctgaatggaataaattgaaaatatctttaaaagttttaatatttaacaaattgataatttttcactgttacaataatctaatgttgaatcatccgtgtagaaatatctttaggcctggttctgtattgattttcctatttatatttgtatcactcttgtatttcatttgattatcggttttttcttataaatgttaagaaataactagtaaattcaattttgcagactcagaatggccgatgaggacgattatcaagatatggataatgatgatttcgttgacgacaacgaaatggaggacgtgatcgaagaagatccacaacgccctgacaatgaggacgaggacgatgacaacgtggacgagaatttcgagcttttcgatcaaggaaaggctgttccgactagtgagcatgtgacaactccattcatgacaaaatacgaacgagctcgagttcttggcactcgcgctctccaaatcgccatgggagctccggttatggttgaacttgaaggagagaccgatccattggagattgctcgcaaggagcttaaacaacgccgtatcccgatcattgtccgccgctaccttccagatggatcatacgaagactggccaaccgatcaacttcaactcgc