Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:123-e3   

Cenix:123-e3RNAiCenix:123-e3
PCR_productcenix:123-e3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF31D4.1 Source_evidenceePCR404WS150 Sequence/Annotation Release
Overlaps_Gene F31D4.1 Source_evidenceePCR404WS150 Sequence/Annotation Release
Chunk_score Abs_score362
Max_abs_score362F31D4.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV2083817320838745
Overlaps_transcriptF31D4.1 Source_evidenceePCR404WS150 Sequence/Annotation Release
WB_DNA_textTH:123-e3573caccccactggatatgaaggatttctctacaaaattagtgaacatttttaaaaagctattgatatattgaaactattttctgtcatatagacttgtttttaaaaaaatattttatacaggctggaatcaaactcgaactagaatcatacgatgctgaaacagaaaaagagccaaaacaaccaattaatttcaacgtggatttctcagccaacgcgagcagtcaattcgctggtattaagctctaaaaatcttaaaaatccaaaaatttcaattattttcaggaaaaggaggcgacgaatacgcagaggaactatcggcagcatttcaagcggcttattcaaaagcactcgatattatgccgaatctcgcgaaaactcagctggccgacggatatcgctggaaaattaatgtggacatttcggttcttcagtgggacggaagtgtttccgatgcgatttctattgcaatcatcggagcattgagtgatttagagtttccagaaggtgacgttgcaccagatgatggaggaaaagtgagaattgtgttgaaacggccgaaagttgctggaaatgt