Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:13-d1   

Cenix:13-d1RNAiCenix:13-d1
PCR_productcenix:13-d1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF58A6.9 Source_evidenceePCR234WS150 Sequence/Annotation Release
Overlaps_Gene (21)
Overlaps_transcriptF58A6.9 Source_evidenceePCR318WS150 Sequence/Annotation Release
WB_DNA_textTH:13-d1318attgaagtccggggaaagttctagatctatttcctatgggttgtactcaattgggaggttcttacggcggaccatgccatctccttggaaccattcccgacggaattgcttagcagcaccatcaggggtgttggtccactcaacagtgatacggtcgttgtttgtatcctcctgaccgaaggcaaaggcatcgcacgaaactgccagaagaactgcctcctttgggtccaaaactccacatggtggatcaactccaagtctcttcatattggtggtcttgataccgtatccaatacggcgagccgaggagttaatcac