Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:13-d7   

Cenix:13-d7RNAiCenix:13-d7
PCR_productcenix:13-d7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK354.4 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (33)
Overlaps_transcriptZK354.4 Source_evidenceePCR416WS150 Sequence/Annotation Release
WB_DNA_textTH:13-d7515aaatttcgatgcccttttccacggctatagatctaggacagagataagaaggttgctataaattgagaacgttttgtcataatcttcactacgagttctcataactccttcaacaagtcgccatggcccaatccgttccaccaggagacatccaaacccagccgggtaccaagatcgtcttcaatgccccatacgatgacaaacacacctaccacatcaaggtgatcaactcatcggctcgccgtattggatacggtatcaagaccaccaatatgaagagacttggagttgatccaccatgtggagttctcgacccaaaggaagcagttcttcttgccgtttcctgcgatgctttcgcctttggacaggaggatacaaacaacgaccgtatcactgttgagtggaccaacaccccggatggagctgccaagcaattccgccgtgaatggttccaaggagacggtatggttcgtcgcaagaacctcccaatcgagtacaacccatagagccctgtg