Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:138-b4   

Cenix:138-b4RNAiCenix:138-b4
PCR_productcenix:138-b4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene D1007.5 Source_evidenceePCR558WS150 Sequence/Annotation Release
Chunk_score Abs_score474
Max_abs_score474D1007.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI45826864583881
D1007.6 Source_evidenceePCR9WS150 Sequence/Annotation Release
Overlaps_transcript (6)
WB_DNA_textTH:138-b41196tcagatcggaaaatgaaggcgtagaataagattctgaaacaaatttattaaatattaaataatttattaaataagttgaattttatcgattctttattaacttttctatgagttggattaattggtctttttatcgatgtttggattatccaaaatgaccaattgcgccattttgttccaaaagctttcattagaatagagaatcactttatttattttaaaatatcattcatttaaatgtaagcatctcaaaaaatgcacaaaaatgtcctgaaacttgtcaattgcctaaaaacaatgctcgataattcgataatcgacaaatttgcaattttcaggtcatttttaagcatttctttgtttaaactgaaataaattatattttaatatatttaaacaaagtgattttctatactttgacactaatttctaataaaaaatgctgaaacaagatggcgcaataggtcaatttgactgtgtatttgcaaaaatccgacaacttacggaaataaaaaccaaagcacagatctactcggaaaatcgtgacagactcgattaaaactgaaaaggaagctcgtaatgatcagtgtcatcactggtgttttaattgctgcatattctacaatcatcaggctcgactgaataaactgcgactggttggcggatattgtggcgatcacttcagttatctgcacaattctttattattgatttctattttaataaatgtaaggcattaccgttttccagaaacagacggttaccctccagccaagtaaaaggccaacacatgacaggaaatatggatttatgagatggaatttctgaaaataatggacatattgaatttcctgttatcctttttcacacttacaagtgaataatgccaatacgacttcggaagccaccaaagagttttgtatatattcagatattgtaaaaataaagccaatactgaatataaaaacaaagtgcattcgaaaaatagctctccttgtgtgaactgaatatccggccatataggatggacggaaagcgttacaccactcgctcttgggattgaagctggcacggaaggagcttgtggtggaggtgccggcactcgtcttcgaggcggcatatcttacttaaattccacaaaatgtattacgattctaggcagagtgacaatgtacttgttgatggaaaattcaccg