Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:141-c10   

Cenix:141-c10RNAiCenix:141-c10
PCR_productcenix:141-c10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW05B2.7 Source_evidenceePCR529WS150 Sequence/Annotation Release
Overlaps_Gene W05B2.7 Source_evidenceePCR529WS150 Sequence/Annotation Release
Chunk_score Abs_score459
Max_abs_score459W05B2.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1098807210989231
Overlaps_transcriptW05B2.7 Source_evidenceePCR529WS150 Sequence/Annotation Release
WB_DNA_textTH:141-c101160gtccaagatgaatcgggagagaaataccaaaggcgctcgaatggaggtgctctccgagctggttgctgtaaaggctaccaatctggaaaccatgagggccgaggaagcagcgttgaaaactacggtagaagcaatggtttcggtaggctttgagttgagggatttgaaaaatcaaacatgtttttttcaggcaccacaagaagaattccggaagtgtgtagaagagctgctcaagttctcaaatacagacatcaaaactctatcgaagatcacaaagccttcagtgggaatacgtttgtgctgtgagatgcttcgcactattttcgagccgaacttcaagccaagtagatttttcagcgctttcagaattgcttcaggtactcaaaataattgttacagaacggcacgcggcagaagcctggacggaatccttaaaatttgtgagcgacaaggcgtttttcatcaagctggccacttgtgacgcggatattttgacggtggaccagatgaaggtactgaagaaatacgtggatcgagccgagttcaacgcaaacaagatcgaacacgagtcggtggtgtgcgcgtgtctttgccgatggatcggagcgtttttggagttggcttggtgagtttttggaggatcttcatagagatcttgagagaaggtccagagattttcgggctttaaacatttcagacaggctaataaatcccatgatcctcaagacctcggagatcctagaaagacaaggtgtcggttcagagtctctggaacttcttcaaaggtcccggggcatgggttgttctataagatagtttgttcgaaagatccgaggggcctgcgttttcagggccccctcaggatttacggctttcttcttatctaggctcgcctgcagattccatccaggctttttagggaatctggataaagctgtgacacctccaggctgttcagaagctccgctttgttttagtcgccctggggtccctggaggttcatctcatcttggtggtcctgggtcttctgggatgtattcggattaagcgtcggatcctgtttgttccgaagctccggcttatcctggttttctggtgctccaatttttaagcccattcattttaagcctaacacccaatcccaattttccagcacactt