Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:141-d12   

Cenix:141-d12RNAiCenix:141-d12
PCR_productcenix:141-d12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y110A7A.19 Source_evidenceePCR1028WS150 Sequence/Annotation Release
Chunk_score Abs_score965
Max_abs_score965Y110A7A.19
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI51637215164837
Overlaps_transcript Y110A7A.19.1 Source_evidenceePCR1028WS150 Sequence/Annotation Release
Y110A7A.19.2 Source_evidenceePCR1028WS150 Sequence/Annotation Release
WB_DNA_textTH:141-d121117atatagccacggtgagctggtgattataggtcttcttttgctcgtcactctctcgtttttcattatccaataatttaaaatctatgatgtttttgataattaaatgaaaagatgacagtgctggttcaactccaatctctttcatttctccaataatttcagtgaacgccttcacacgatcttcaaactttccagcttttgcagcagacgacagtaatgcattgaacgtgaaaatatcgggtgtcattctgagggaaatcatttcagctaccaatttcttcccgacactgtagcttgaagcgccaattaatccattgaacgcttctcggtaaacttttccttttgcagctcgatgctccttgtacaattctctagctctttccaaactagaatgatcagaaaacttgcatagaccagcaatcattatagaaacggtttcatcagtttttgggagagtttcgaaaagaagatcagcgactgcacccgatttccatgaggatgtagaatcttctccaaaattgcgcattccaacaaactcctcccattctgcgaaaggtacgtttgacgaattgtaataggttacaagacggaatagttccagctggactttctcgctaacgtcaacgttctctgatcgcatgcgttcatacaaaatacacgagtcttttacttctcgacttgaaatcattttaagcaggttattctctgtcggttcaacttgaaggggatctgctagatgtcgaggacggaaaaccgggagctgaggttgatctctgtcaaaagcgaagagggttggccattctgtagctagttctcgtgcagctcttttgccaaactcctaaaattatcaaacttattctaatattccggcaaaaattttaccttcgccataaaataggtctttttcgttgactgcgtggaaggaatggtaattggatcgtcaatgtaggcaaaatgtggagcagttgtgtccgggccaacggtttctgacaaggcatttaacaaatctgttggagatctctggaaatatagaagttcaagtatgaatttttaaaaatagtcaacctcgattgctggctgtattgtcaatttttgagataatgcaggctcaaccgac