Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:142-b11   

Cenix:142-b11RNAiCenix:142-b11
PCR_productcenix:142-b11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK637.3 Source_evidenceePCR529WS150 Sequence/Annotation Release
Overlaps_Gene ZK637.3 Source_evidenceePCR529WS150 Sequence/Annotation Release
Chunk_score Abs_score474
Max_abs_score474ZK637.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII88920088893207
Overlaps_transcriptZK637.3 Source_evidenceePCR529WS150 Sequence/Annotation Release
WB_DNA_textTH:142-b111200gcaggcaaccagagtgagtttaacaatttttattttaaacaggatgtggttgtatacttttaaaaaatgttctatggcttgataaggcgttatgtatatctgattctttaaaagttccaaaaatcaacctcttcgtctattgaatttgaatttcgatttttaattttctttgagttttgtaagaaacgcggccgtgtactcttctcggacaattaactaattaaatttttggatttcaagtaatttttcgcattttcttgatttccctcggtatgttgtaacagatgcagagacgcattttactttaattaacagaccactcactcctaaatacagtaatgtatcttgttctgctgatgaatgacacttctaaaatcacatagtttattcattttcctgtttttcattgaataatcaatttgatagtgttatcgattttcattagaaataacgggaagtaacgagaaaatactaggacatggcctaaaattcaaaaatttaattaattaatagtacgagaagagtaaaaataggaagatcagacttgatttcccaaaaataacttcagttaactgaataatgcaaaaaaaattacctttcattaatcaaaatttgaataatttcaggccaacactcgccctgtgatcaaagtaatggacaatgcagaatgtacaaaatgtgaaaagaacggaacacgacgattcgaaatccgagctcaagagaatattcaaccaaaaaatatgtctctcggagtcatcaaaatgggaacattttttgatcttcttgaagatggatcattggatcttcttgttgagtatgaatacggtggtcagacacgttttggattcatctactgccctgataaaggagatacaacattcttgaaagttcaagttttcacaggagtttgcagtgatcgatgcaatccaaaatcaaacgagattggatcgagtatcagtatgactggtgcatgtgcttctttctcaatgacagatggatggggaggtagtacacagagtgtagcatgtcaagttccggcttcatcaaatagagcactttatctcccatttttgttgtatggtcttggaagaagtccaaattttgtggatgaggtaatttcatatcttctagatattttcgttcaattattccaaataatctttttttcagttgaatattgccattccgaaatacgcagat