Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:142-c2   

Cenix:142-c2RNAiCenix:142-c2
PCR_productcenix:142-c2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY38H8A.4 Source_evidenceePCR553WS150 Sequence/Annotation Release
Overlaps_Gene Y38H8A.4 Source_evidenceePCR553WS150 Sequence/Annotation Release
Chunk_score Abs_score448
Max_abs_score448Y38H8A.4
Specificity_index0.742
Rel_score1
Map_statusUnique_ePCRIV1347109813472295
C27D6.11 Chunk_score Abs_score156
Specificity_index0.258
Rel_score0.348
Overlaps_transcriptY38H8A.4 Source_evidenceePCR553WS150 Sequence/Annotation Release
WB_DNA_textTH:142-c21198tacgcgagaagccaaaatctccgagtttgacgttctcgtacttgtcaagaaagatgttctcgcacttgaggtcacggtgcacaatgttatatgattggagatgctgaaaatgtaaagttcagagtatttgaaatgtttagtaatctgaaatgacgtcaaatttctctttaaaaaattgccgctatttctggagatcaaaaaggtgatgctaacgatgtcggtgtaccggaattcacaaaatcttacgcgcatttagtaaaagtcgtggtataccgtatacgtatacggtagataaattgcgaacagttaatccgaccctgtttctgagggaaatttcagaaaactaaccatgagagctgcgatgaactgacggaaggtgaacttcgcgttctcttcactcattgtcttgatcttcttcatttttcgaagcaagtctcctccagcacaaaactcggtgacaaaaatgatatgatcagggaaggagatcatttcatacaaacggcagacgttgtcatgtttcagaagcttcacaatctccttctcacgtggcaagaacttcttgatgtagtcatctttttcacgggtcggagtgatgttgatcaccttcgccgccacttcaagcttcttatcgccccacgtggcacgggccactcgagagtacgatccgctgcctggaaatttagaaattaagtaagtttataaatttaattgttcagcaaagtctccagctcatttttgaaggaagttatgagcgtttgaagttgacagtgtggaagaggaaaatagtgtggagaaaggagagaggggaaaagacagagcgtctgcgcctgcctgcccgcgtccacaatctctcactccaacaacttcagaccctgtaacttcctccaaaaacccgctagagacttcattcaaagaccatttttgagccctaaaccttacctagaatcttatcaaacttcagcttgtgctccttctcaagagtcggcgcaaatgccttagtcctcgggctcaactcgtcaggttcttcctgattttcagacgcatctggaaatagtttattttagtgctgaaagtaaccttgaatacacttaccagtgctttcttcgtttaccattttcaacgacttgcaagagaaatagaaagccaatcaaaataattattgattttttcaaagactggggaggaggaactgttggtt