Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:143-d5   

Cenix:143-d5RNAiCenix:143-d5
PCR_productcenix:143-d5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T21H3.3 Source_evidenceePCR595WS150 Sequence/Annotation Release
Chunk_score Abs_score511
Max_abs_score511T21H3.3
Specificity_index0.831
Rel_score1
Map_statusUnique_ePCRV11559981157126
Y73B3A.12 Chunk_score Abs_score103
Specificity_index0.169
Rel_score0.203
Overlaps_transcript T21H3.3.2 Source_evidenceePCR591WS150 Sequence/Annotation Release
T21H3.3.1 Source_evidenceePCR595WS150 Sequence/Annotation Release
WB_DNA_textTH:143-d51129tttcacccaccggtattcatcattgtttacgtcgttccgctcgctttcaaacaatttatattgattttaattaattaattaattatcctttttcatttttcagggttttctaacaacaccccctgcacagcgaaagcaagatggccgatcaactgaccgaggagcaaattgccggtacttttttaaattctgattgatggacggaggaccgggagattgaagaaatctaatcctctctcatttcgaagcgaattgagcagaaaccaagcggcgcggcgtagaaatttaaatttaatggatgaaacattagccgtagcagcagatgtatagcgccactatttttgtgtgttttattccagatgttggctggttctcgcggcgaaaaatctatcaacaattgtataaaaaactacaaaattcgagaaaaaaccaaatcaattttgccaaattttcagagttcaaggaggcattcagtttgttcgacaaggacggcgatggcacaatcaccaccaaggaattgggaactgttatgcggtctttgggacaaaatccgactgaagccgagcttcaggacatgatcaacgaagtggacgctgacggaaacggaaccatcgatttcccagagttcttgacgatgatggcccgcaagatgaaggacacggacagtgaggaggagattcgtgaggcgttccgagtaagagatttgtggaaatttataaattcatttttgattcactatagagaagcctcatgtagtatagaaaatctcattcaaatcttcctatttgcaggttttcgacaaggacggaaatggcttcatctcggccgctgaactgcgccacgtcatgaccaacttgggagagaagctaacggacgaagaggtcgacgagatgatccgtgaagccgatatcgacggagatggacaagtcaattatgagggtgagtccttacaagacctttttttttcgaaatttcatcaaatttcccatatttcagagttcgtcaccatgatgacaaccaagtaaatcacaccaatcgggatctgaagccgccgtatcgtttgcgaatcaccaacaccttttctctcacctttcgtttttttattcttccccgcttgaaaattgtgatt