Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:143-d7   

Cenix:143-d7RNAiCenix:143-d7
PCR_productcenix:143-d7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW03C9.1 Source_evidenceePCR724WS150 Sequence/Annotation Release
Overlaps_Gene W03C9.1 Source_evidenceePCR724WS150 Sequence/Annotation Release
Chunk_score Abs_score619
Max_abs_score619W03C9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1196099911961916
Overlaps_transcriptW03C9.1 Source_evidenceePCR724WS150 Sequence/Annotation Release
WB_DNA_textTH:143-d7918cgagattgcagaatgagggtacactgtgtggctttttttgaaggcgaggcgatcttggttgaggcggagcaaacgggagtctgatatatagagatgtggatgtatatggattactgtatgtaccttgaatattcagcggaatgcttgatcgggaagattttagggttgccgggtcaatcttcagggatgggacatcgaatagcgaatcttcttcgtcggtgcactgaaatttaaaatatttcggattttgatcaagaaatttgaattcagctcaggttactgtagcttttcgtggtgggacccacattttttttttcaaactcaattcaaactcaatatacttatacttaaagttaattttacacgattttacacgtacatagtagtcctgtgggctcttcttgccacgccgagtttgtcgcacacgagatctcagtttttccacgtatttcggcggcggagacggcagaatttgcagtccgtcgagcttctcgtcatcactgaacttgtagttatcactgagaggtgactcgtgttctggaaaatttgaatttcgcgggatggttctcaatggggcgcacttgccgtcgtcctcagtgatcgattcttgtgtggaatccaacgtgggttcgctaccgaccgcggttttcaaatcctcgtcttttccgtgattgaaaacgaaaaatttcgaaagtttcttcgcctttttgtcctttccatcgacttttttcacagtttttcctggttttatctgagaaatttgaatttgccacccattagcactagagcgcacttaccttcttctcgtcttttttcggtttcacagcgactggcaaagtttttgtgtaagcttctgaggggtcagcagatcccttaaacttccaagccgttttcaggcacgagacgagtgcgaaactt