Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:145-c8   

Cenix:145-c8RNAiCenix:145-c8
PCR_productcenix:145-c8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (2)
Overlaps_Gene B0334.11 Source_evidenceePCR883WS150 Sequence/Annotation Release
Chunk_score Abs_score791
Max_abs_score791B0334.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1149413311495275
Overlaps_transcript (2)
WB_DNA_textTH:145-c81143ctatcaatggagcaccgtcatatagatttctggaaaaattaatttacagctttttttatgaattcgtcaaaaaatacctgaagaataaattaaagtgcttcgcagaaccagaaaaaaacgcaaagaatcctccggaaatagtctcagaaaacacttcgatgatagaaatctcgtggaaaatcgatatggtttgactctgaaatttacaacatttaaaataatttaacccaacaaagaagaaataaaacaaaaactaacctcaatgtactttaaacattttgatttttgccgatattggaaaggcgatgcgaggatttcaaccattcttgagagtaatccttctgtagcacaagaatcatgagcatgctcttggaattgtgcaaatcttcgtgattctgcttcttgatattttttgctataaccagaatacatggaaacaagaagagcagttgagagaacgagaatccaaaagtttcgtggccgaacgattgatcgaagaacaacaaaagcagccgcgggcaaaatgaagatgttcagtgtgaaaatgaaaggttggagagtcacaaatgtatcctgccaagtacgatctggagctggaggcttcacgctgaaaatgtttgacaacgcggatcggacggcttctctctcttcagccaaatctgcttcatcattttttaaatacttcgaaagaaccgacatgctgtgccgagatattttaattctgcaattcaaagcttaaaatatatcggaactagaagaaaatatactcactgtacatcttttttaattgaaccttccaaatgatagtcaattttggtttcgtggagaagttgtcgaagaatcagacgaagactttgatcaggctgaaactattgaatgggttatttacggatttctttaaagcttttagtttaccttctgaacttgatttcgaacagatagaagtcgttttgacgctggcgggctttctccagaagttggatcattcggatctttccacacattttcatgtgtaaattcttcgtcaatgtcttgagttgcgaaaagttgcgggacgaggagtagaagtgtgacccatattattttcatctgaaacaagcggaaagttgaaagagaaaagatgtttacagcacgctcagcaac